• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to hepatitis B virus anti­gens and hybrid antigens containing them and to the cloning of genes which code for said antigens in yeast by use of recombinant DNA techniques. Said antigens are valuable for the preparation of vaccines, e.g. hepatitis B virus vaccines or malaria vaccines.
    公开号:SU1746887A3
    申请号:SU884355055
    申请日:1988-01-26
    公开日:1992-07-07
    发明作者:Кабезон Тереза；Де Вильд Мишель；Харфорд Нигель
    申请人:Смит Клайн-Рит (Фирма)；
    IPC主号:
    专利说明:

    The invention relates to genetic engineering, in particular to the production of bifunctional antigens, the cloning of genes that encode these antigens in yeast.
    A known method for the preparation of the HBsAg-Herpes hybrid polypeptide simplex I virus glycoprotein D (HSV-lgD) upon expression of the sequence coding for the hybrid HSV-lgD-Pre S2-S protein in yeast.
    Closest to the invention is a method for producing a hybrid polypeptide containing HBsAg, which consists in constructing a recombinant plasmid DNA encoding the fusion polypeptide, transforming the obtained DNA of Saccharomyces strains, cerevlsfae, isolating and purifying the target product.
    The way is. that the 64 codons of the DNA sequence encoding the twisting epitope of the circumsorotic protein (CS) of Plasmodlum falclparum and the eight codons of the CS coding sequence of the Pre S2 protein are inserted into a vector expressed in yeast, and it consists of a replicon or a Pre S2-S protein sequence and the corresponding regulatory region. Both expression vectors, namely one containing a sequence of 64 codons, and the other containing a CS sequence of 8 codons, are each transformed into recipient yeast cells and the extracts of such transformed cells are analyzed for the presence of HBsAg epitopes and CS epitopes on the same molecule.
    New sequences encoding Pre S2 and Pre S2-S HBV protein are obtained from the adW subtype of HBV. which was isolated from the plasmid pRIT10616. The sequences encoding the Pre S2-S protein are extracted using traditional recombinant DN K procedures from the plasmid pRIT 10616. The Pre S2 sequence region is characterized by
    Yo
    V4 4 O 00 00 H
     Gj
    is the following amino acid sequence: 5O
    Met Gln-Trp-Asn-Ser-Thr-Ala-Phe-HIs-Gln-Ala-Leu-Gln-Asp-Pro-Arg-Val-A rg-GJy-Leu-Tyr-Phe-Pro-Ala-Gly- Gly-Ser-Ser-Ser-Gly-Thr-Val-Asn-Pro-Ala-Prff Asn-tle-Ala-Ser-Hls-lle-Ser-Ser-Ser-Ser - Ala-Arg-Thr-Gly-Asp -Pro-Val-Thr-Asn.
    The functional derivative of Pge S2-S according to the proposed method is a derivative in which the amino acid alanine (GCT) at position 45 is modified by site-specific mutagenesis to threonine (ACT).
    The recombinant plasmid DNA consists of a sequence that encodes a PrE S2 and PrE S2-S protein ligated to the regulatory region.
    Example 1 Construction of Plasmid PRIT10167
    The starting material used is a rbu plasmid containing a 2.1 Kb Hldn III fragment of yeast DNA encoding the TD NS gene cloned into pBR 322. The Hind III fragment of the yeast DNA is cloned into pBR 322, in which the EcoR I site is destroyed and pRIT10164 is obtained.
    PRIT10164 DNA is purified by CS gradient centrifugation of CI-these l bromide. 150 μg of pRIT10164 DNA are treated with 75 units of the Xbal endonuclease, extracted with phenol and ether, precipitated with ethanol in DNA, resuspended in 0.01 M tromethamine-HC1-buffer at a concentration of 1 μg / μl | 20 µg of Xbat-treated DNA is hydrolyzed with Ba131 to remove 61 bp. DNA between ATG codon and Xbal site. Treatment of Ba131 was carried out at 30 ° C for 1-3 minutes in a buffer containing 600 mmol of sodium chloride, 12 mmol of calcium chloride, 12 mmol of magnesium chloride, 1 mmol of ethylenediaminetetraacetic acid (ED TA), 20 mmol of tromethamine-HCl, pH 3 , 1 using one unit of Ba131 nuclease per 20 μg of DNA in the final reaction volume of 200 μl.
    The reaction is stopped by adding ethylene-bis (oxyethylenetrilo) tetraacetic acid (EGTA) to obtain a final concentration of 20 mmol, and the samples are extracted with equimolar volumes of phenol, ether, and precipitated with ethanol. Each DNA sample is resuspended in 20 μl of 10 mM tromethamine-HCI buffer, pH 7.5.
    The degree of hydrolysis of Ba131 was measured by treating a 2.5 µg sample of the Hpal DNA with the nucleonase Hpal and by comparing the size of the Hpal-Xbal fragment with the 335 Lp Hpal-Xbal fragment from pR T10164, Two-minute hydrolysis of Ba131 removes 41-88 nucleotides from the Xbal-Hpal fragment plasmids pRIT10164. 5 µg of DNA are treated with the endonuclease BamHI, extraction is carried out with phenol
    and ethanol precipitation. This DNA is treated with 5 units. T4 polymerases in the presence of triphosphate deoxynucleotide in order to fill the BamHI and Ba131 ends, extracted with phenol and recovered
    0 precipitation with ethanol. 2.3 μg of this DNA is treated with 5 units. T4 DNA ligase and half of the cross-linked DNA are used to transform competent E.coll K12 cells of strain MM294. 1 ml of the transformed E.coll 5 population is diluted in 350 ml of L-broth with 200 µg / ml ampicillin and the total plasmid DNA is purified from the resulting culture.
    80 μg of this plasmid DNA process 75 units. Hind III endonucleases and 96 units.
    0 BamHI endonuclease.
    The target Hind lll-BamHI fragments, corresponding to sizes 1100-1000 Lp, on the preparative 1% agarose gel were separated from the gel in two sections, one
    5 corresponds to DNA with a size of about 1070 Lp, another is 1030 Lp. DNA is extracted from two agarose gel sections using freeze and thaw cycles, followed by centrifugation of the agarose with
    0 high speed. The upper layer of the liquid is filtered off using filters and the DNA is extracted using two cycles of ethanol precipitation and resuspended in 20 µl of 0.01 M tromethamine-HCl buffer
    5 7.5.
    Analysis of agarose gel by electrophoresis and comparison of hydrolyzed Hind III-Xbal plasmid pRIT10l64 DNA and with fragments from Hind III EcoRI phage ADNA
    0 indicates that two different Hind lll-BamHI fragments are obtained, one is 1070 Lp and the other is about 1030 Lp, compared to the 1120 bp Hind Ill-Xbal fragment of the plasmid pRIT10164. About 100 ng
    5 fragments of 1030 bp Hind lll-BamHI are ligated with 200 ng of plasmid pl) C9, which is treated with Hind III and BamHI endonucleases and alkaline phosphatase. The resulting DNA is used to transform E. coli cells.
    0 strain J M103 with selection for resistance to ampicillin.
    About 400 ampicillin resistant colonies per ml and 98 colonies are obtained and tested in medium containing X-gal.
    5 Plasmids from transformed colonies are obtained after amplification of plasmids by adding spectinomycin (150 µg / ml) to growing cultures.
    Recombinant plasmids are analyzed on a 7.5% acrylamide gel after
    hydrolysis with AVall and BamHI endonucleases and compared with the 450 Lp fragment of AVall-Xbal, including the promoter-L-terminal coding region of pRIT10164, and the Hpall DNA fragment of the plasmid pBR322. The AVall-BanrfHI fragment is present in 35 of 36 plasmids. Three plasmids are chosen for further studies. Plasmid DNA was isolated by centrifugation in a density gradient of CSCl-ethyl bromide and 25 µg of DNA was hydrolyzed with EcoRI. EcoRI ends are met y-P-ATP.
    Example 2: Vector Construction PRIT10172.
    The 1050 LP Hind lll-BamHI TDH3 DNA inserts from pRIT10167 are cloned onto the shuttle vector YEp13 and the recombinant plasmid pRIT12059 is obtained.
    The plasmid pRIT12159 DNA is hydrolyzed with Xbal and BamHI endonucleases and the 1650 LP fragment is ligated with the Xbal-BamHI fragment containing the arg stimulator on the plasmid pRIT10774. Plasmid pRIT10774 includes the YEp13 replicon, from which the BamHI and Xhol sites were removed by in vitro manipulation with the 1470 ba Hind lll-BamHI fragment, including the arg3 stimulator region, and the 1150 bp BamHI-Hind ill fragment, which includes the arg3 transcription termination region. Replacing the arg stimulator with pRIT10774 by a TDH3 stimulator yields the plasmid pRIT10172, which contains a single BamHI site located at the ATC codon of the TDH3 stimulator and precedes the transcription termination signal for the 1150 bp BamHI-Hind III arg3 DNA fragment. Alien DNA can be cloned in this site.
    PRI me R 3. A 1050 bp Hind IM-EcoRI fragment from pRIT10167 and a Hind lll-BamHI TDH3 fragment containing the stimulator, together with part of the BamHI-Smal-EcoRI polylinker pUC9, is cloned between the Hind III and EcoRI sites of the plasmid pBR322, which was previously removed the BamHI site by filling with T4 polymerase DNA and ligated,
    Plasmid DN To pRIT 10158 is treated with the endonuclease EcoRI and T4 DNA polymerase to fill the EcoRI ends. This preparation is treated with endonuclease Clal. DNA pRIT10158 is hydrolyzed with endonucleases Clal and Hallll and fragment 1150 LP Cla-Ha l) l. the carrier region of the arg gene transcription is extracted by preparative electrophoresis on agarose gel and electroelution. This fragment is ligated with the plasmid DNA PRIT10158. treated with EcoRI, T4 DNA polymerase, Clal, and ligated mixture
    used to transform E.coll cells of strain MM294. A plasmid was isolated from the transformed colonies, in which the Clal-Haelll fragment of the arg3 transcriptional termination 5 was inserted between the Clal sites, the EcoRI site was filled and restored. Plasmid DNA pRIT10162 is treated with EcoRI and Pst endonucleases. the mixture is ligated and used to transform cells
    E.coli K12 strain MM294. The plasmid pRIT 12208, in which a large fragment of 4630 lp EcoRI-Pst I from pRIT12176, is ligated with a fragment of 1930 bp EcoRI-Pst I from pRIT10162, in which the arg3 region of the window is crosslinked with a TDH3 stimulator, fragment 2200 bp Hind 111 from pTIT is extracted with a RTH stimulator; The Hind III site of the plasmid pBR322, in which the EcoRI and BamHI sites are removed by filling the poly4 with T4 DNA and ligating. In both plasmids pRIT12208 and pRIT12290, the fragments of the TDH3 stimulator and the arg transcription termination are separated by the BamHI, Smal and EcoRI sites, and the stimulator and transcription regions can be cut together on a 2200 bp Hind IK fragment.
    The BamHI site is useful for cloning, since it is located at the ATC codon of the TDH3 gene and can be used for fusion
    0 other genes with TDH3 stimulator.
    Example 4 Construction of the plasmids pRIT10677, pRIT10909 and pRIT10158. a) pRIT10677. The BamHI fragment 1372 bp cloned HBsAg DNA is cut out from pRIT10616 and ligated with the PBR327 vector. treated with the endonuclease BamHI. This BamHI fragment contains part of the HBsAg precursor region. Get a plasmid
    0 pRIT10677, which has a BamHI HBV fragment inserted at the BamHI site of the vector in such an orientation that the Xbal site in the HBV DNA is located close to the Sail site of the PBR327 vector.
    5c) pRITT0909.
    A 3300 bp Hind ill fragment from the plasmid pMS200 is cloned into a derivative of the plasmid pBR322, in which the EcoRI site is removed by filling with T4 DNA polymerase, and
    0 by repeated ligation, plasmid pRIT10158 is selected, in which Hind III has 3 regions of the arg3 gene. The 1150 bp Clal-Haelll fragment is extracted from pRIT10158, and contains the transcription terminations of the arg gene. This
    5 fragment 1150 bp is ligated with the Clal-Hpal DNA fragment of plasmid pRIT10677. Get plasmid pRIT10909.
    PRI me R 5. The site of BamHI pRIT10167 (example 1), located in the region of the precursor of the HBs Ag gene, from the HBV virus
    The adW serotype cloned into pRIT10616 is in the same translational reading frame. The source of the HBV DNA fragment is the plasmid PRIT10909. The 2085 bp EcoRI-BamHI fragment was isolated from pRIT10909 and the plasmid pRIT10909 was inserted into the EcoRI and BamHI site and the plasmid pRIT10911 was obtained. Fragment 3134 bp Hind III from pRIT10911, containing the transcription signals of yeast DNA and HBsAg DNA, is inserted into the shuttle vector YEp13 to obtain the plasmid pRIT10912.
    Example Plasmids were constructed, in which excess nucleotides of the end of the DNA fragment encoding the N-terminal part of the HBsAg were removed. The 1225 bp FnUD II HBV fragment of DNA from pRIT10616 and the HBsAg-encoding gene are cut out from this plasmid and ligated with EcoRI, the fragment is cloned into the EcoRI site of the vector pACYC184 to produce pRIT10679. A 125 bp EcoRI-Xbal fragment is obtained that contains the terminal region of the HBsAg precursor. HBsAg ATG codon and 90 bp -HBsAg coding sequence, This 125 bp EcoRI-Xbal fragment is inserted into the EcoRI and Xbal sites of pRIT 10158. The resulting plasmid pRIT 10903 contains a single 1 EcoRI site located at the junction between arg DNA and HBV DNA and The only Xhd site located in the stimulus area.
    150 μg pRIT10903 plasmid DNA. which is obtained by centrifugation in a CsCI density gradient of ethylene bromide, treated with 80 units. EcoRI endonucleases, after which they are extracted with phenol, precipitated with ethanol, and resuspended at a concentration of 1 μg 1 μl in 10 mM tromethamine-HCI buffer (pH 7.5). DNA was divided into three samples of 50 µg each and incubated for 50, 75, and 90 s with Ba131 nuclease at 30 ° C. To 50 µg of EcoRI DNA treated with pRIT10903, add 2.5 units. Nuclease Ba131 in a final volume of 500 μl. The reaction is stopped by adding EGTA to 20 mM final concentration, cooled on ice, extracted with an equivalent volume of phenol and precipitated with ethanol. DNA samples treated with Ba131 are taken in 50 µl of 10 mM tromethamine-HCI buffer and 2.5 µg are further treated with the Bst Ell endonuclease, a 285 bp fragment of nuclease is isolated for 75 seconds at 30 ° C, reducing the size of the fragment. Eco RI-Bst Ell to 10-60 main pairs. Deletion of 29 major pairs from the Fnud II site removes the entire HBsAg precursor DNA and the HBsAg ATG codon.
    5 μg of pRIT10903 DNA is processed for 75 s of Ba131, 8 units of hydrolyzing are hydrolyzed. Xhol
    nucleases, extracted with phenol and precipitated with ethanol. This DNA is then incubated with 5 units. T4 DNA polymerases in the presence of dioxynucleotide triphosphate to fill the Xbal and Ba131 sites are treated with phenol and precipitated with ethanol. The DNA is then incubated with 5 units. T4 DNA ligase for 16 hours at 16 ° C and the mixture is used to transform competent E.coll K12 cells
    strain MM294. About 2,000 ampicillin-resistant colonies per ml were extracted after seeding, and plasmids were isolated from 47 individual colonies.
    One plasmid containing a fragment
    Xhol-Xbal size of 95-100 main pairs. selected for research. The DNA of this plasmid is purified by centrifugation with a CSCI-ethylene bromide density gradient and 25 μg of this DNA is hydrolyzed.
    140 units endonucleases Xbal.
    The ends of Xbal are labeled with y-32P-ATP and the labeled DNA is treated with 15 units. endonucleases Hind III. Fragment 765 bp Hind III - Xbal isolate acrylamide gel electrophoresis and electroelution. then precipitated with ethanol. The nucleotide sequence around the Xhol site is determined by sequential analysis of this fragment from the labeled end of Xbal. Data
    Sequences indicate that the Xhol site is located on the first basis of the second coding sequence HBsAg: Xhol.
    CTCGAGAAC.
    HBsAg nucleotides. PRI me R 7. Plasmid pRIT10911 is used as a carrier for further manipulations. Plasmid hydrolyzed
    endonucleases BamHI and Xbal, and this fragment is substituted for the fragment 2275BamHI-Xbal from the plasmid pRIT10158 The plasmid pRIT12J-11 is obtained.
    The pRIT12211 plasmid is treated with Xhol and Xbal endonucleases, and the 1600 bp fragment is removed. This 94 bp fragment is purified by acrylamide gel electrophoresis, the corresponding gel slice is extracted and the DNA is extracted with ethanol
    precipitation.
    Plasmid pRIT12209 is purified by centrifugation with a density gradient of a mixture of CS Cl-ethyl bromide and 50 μg of pRIT12209 DNA hydrolyzed with 90 units of the BamHI endonuclease and 60 units. Xhol endonucleases to remove 990 bp of peripheral DNA between the TDH3 stimulator and HBsAg coding region and then extracted with phenol and precipitated with ethanol. 16 µg of this DNA are incubated for 30 minutes at 30 ° C with 20 units of Mung Bin nuclease in a volume of 125 µl.
    The buffer used for incubation is 30 mmol sodium acetate (pH 4.6), 250 mmol sodium chloride, 1 mmol zinc chloride, and 5% glycerol. The reaction is stopped by adding sodium dodecyl sulfate to obtain a 0.2% final concentration, extraction is carried out with an equivalent volume of phenol, and then precipitated with ethanol. An aliquot of 0.5 µg of this sample is incubated with 2 units. T4 DNA ligase for 16 hours at 16 ° C and then 2 units of the Bam HI endonuclease are processed to destroy any vector molecules. This mixture is used to transform E.coll K12 cells of strain MM294. about 2000 ampicillin resistant colonies are recovered.
    Four plasmids are taken for further investigation. The DNA of each plasmid is digested with Xbal by endonuclease and labeled with y-32P-ATP, then hydrolyzed with Hind III endonucleases and the labeled 1190 Lp Hind Ill-Xbal fragment is isolated by electroplating and ethanolic precipitation followed by acrylamide gel electrophoresis. The sequence of each phrase is determined by the methods of chemical modification of Maxam and Hubert. Two plasmids have the exact ATGGAG AAS sequence for complete fusion of the TDH3 stimulator region with the HBsAg gene. One of these plamids (pRIT12230) is used in further manipulations. The DNA of this plasmid (pRIT122 30) is hydrolyzed with the Hind III endonucleases and the 300 HP fragment, containing the HBsAg coding sequence fused to the TDH3 stimulator, is ligated with the shuttle vector YEp13. The obtained plasmid pRIT12265 transform yeast strain DC5 (MATa, leu 2-3, leu 2-112, his 3, can 1-11).
    PRI me R 8. 25 μg of DNA pRIT12230 is hydrolyzed with the endonucleases Accl and EcoRI. The pRIT12230 contains a single Accl site. located in the S-gene coding sequence for 7 nucleotides in front of the TAA stop codon. Electrophoresis is carried out by DNA hydrolysis on a 1% agarose gel and the 4200 Lp vector fragment is extracted from the gel using electroelution and ethanol precipitation. Artificial DNA binding molecules composed of a 12-membered (12-mer) coil and a 14-membered (14-gpeg) linker with the following sequences are synthesized for insertion between the Accl and EcoRI centers of pRIT12330:
    5 ATACATTAAGG 3
    12 tag.
    3 TGTAAATTGCTTAA5, 14 tag.
    100 pmol of synthetic 12 tag and 100 pmol of synthetic 14 tag linker are mixed together in a final volume of 10-20 μl. heated at 70 ° C for 15 minutes slowly return to room temperature over 3 hours and ensure that two turns are fired together with their complementary sequences. To this annealed mixture, 0.15 pmol (400 ng) of 4200 Lp Accl-EccRI fragment of the pRIT12230 10-fold concentrated buffer is added to ligate if 2 units. T4 DNA ligase.
    5 This mixture is incubated for 4 hours at 16 ° C before adding an additional 2 units. T4 DNA ligase and then incubated overnight on ice. The mixture after ligation is used to transform the com plete cells of strain MM294. Plasmids are isolated from 12 or more individual colonies.
    The plasmid with the Accl-EcoRI insert is hydrolyzed with EcoRI endonucleases and treated with alkaline phosphatase. The 2650 bp Hind III fragment of pRIT10162 is cloned into the Hind III site of the pBR327 vector plasmid, and plasmid pRIT12288 is obtained.
    PRIT12288 obtained Fragment 1180
    0 bp EcoRI. which carries an arg transcriptional termination region. This fragment is cloned into the EcoRI site of the derivative pRIT 12230, which is treated with alkaline phosphatase.
    5 The 2900 bp Hind Ill fragment from PRIT12322 was isolated.
    PRI me R 9. Plasmid pRIT12322 contains 2900 bp Hind III fragment. With all necessary signals for expression
    0 HBsAg from TDH3 stimulator. This fragment is ligated with a shuttle vector for introduction into yeast cells.
    The DNA of the shuttle vector YEp13 is treated with the endonuclease Hind III and alkaline
    5 phosphatase and used as a recipient for the introduction of the HindIII fragment from pRITt2322. Plasmid pRIT12329 is obtained, which consists of the YEp13 replicon together with a 2900 bp Hind III modular fragment.
    0 P im er 10. Plasmid WP201 is obtained by introducing an EcoRI fragment from AmPfl into the pUC8 vector. WR201 plasmid fragment containing the CS protein coding sequence minus the first
    5 52 Lp, purified by electroelution from a 7.5% polyacrylamide electrophoretic gel. This fragment is processed with Sau FOR. The pAT10911 plasmid's WATN located at the ATG initiation codon is in phase with the sau C5 sites
    Plasmodlum falciparum. The plasmid pRIT10911 DNA is treated with BamHI with endonucleases, alkaline phosphatase, extolated with phenol and recovered by precipitation with ethanol. 0.2 µg of this DNA is mixed with 0.2 µg Sau Sau of the Stu l-RSal CS-treated gene, treated with T4 DNA ligase, or the modified mixture is used to transform competent E.coll K12 cells of strain MM294. 32 plasmids were obtained from individual transformant colonies after plasmid amplification by adding spectinomycin (300 µg per ml) for growing the culture. Recombinant plasmids were analyzed on a 7.5% acrylamide electrophoretic gel, after hydrolysis with BamHInXbal endonucleases.
    Hind III fragments pRIT12572 and pRIT12571 containing the TD NS3 stimulator, CS-HBsAg hybrid coding sequence, and the arg3 termination region, are again cloned into YEp13 and the plasmid pRIT12574 and pRIT12573 are obtained.
    Plasmids pRIT10912, pRIT 12574 and pRIT12573 are introduced into S.cerevlslae yeast strain DS-5 (a, leu 2-3, leu 2-112, his 3, Can) and into S.cerevlsiae yeast strain 10 S 44C (pep 4- 3, leu 2-3, leu 2-112) by transformation of cells treated with lithium acetate.
    Plasmid DNA pRIT12572 or pRIT12571 is hydrolyzed with a BamHI endonuclease and treated with alkaline phosphatase. The 1215 bp Stul-RSal fragment of the WR201 plasmid is treated with the SAU endonuclease and the 192 Lp and 24 Lp fragment are isolated. These fragments are mixed with pRIT12572 or pRIT12571 vectors that have been pretreated with BamHI, alkaline phosphatase and TH DNA ligase, transform E. coli K12 cells. Plasmid screening from transformant colonies was performed. The presence of the BamHI site on such plasmids confirms the introduction of a 192 Lp or 24 bp SauA fragment in the exact orientation for fusion in the ATC codec.
    The pRIT12309 plasmid consists of a Lp 2 micron DNA sequence from yeast, cloned into the EcoRI site of the plasmid vector pBR327, 6318 bp 2 micron DNA sequence is obtained from the VC plasmid pC.
    2850 bp Clal-Sall fragment containing TD NZ-arg3 and the pBR322 sequences located from the pR | T12290. cloned in the vector pRIT12309 between the Cla and Sail sites. The resulting plasmid pRIT12314 is digested with the Sail endonuclease and ligated with a 2218 bp Sall-Xhol fragment from YEp13 containing the yeast Leu 2 gene.
    Plasmid pRIT12544 is obtained from colonies in which plasmid DNA contains
    2218 bp Sal l-Xhol fragment with the leu 2 gene, which is introduced into the Sal site).
    The 3328 bp Hind III fragment of the pRIT12574, and also the YEp13 DNA is cloned into the pBR322 ABamHI plasmid and pRIT126Q8 is obtained.
    0 2550 bp BamHI-Sall fragment from pRIT12608 containing the CS HBsAg, arg3 transcription termination region pBR322 sequence, cloned between the BamHI and Sail sites pRIT12544 and get
    5 plasmids pRIT12658.
    PRI me R 11. Transform yeast (Saccharomyces cerevisiae) strains of DCS and 10 S 44C each of the plasmids PRIT10912, pRIT12573, pRIT12574 or
    0 pRIT12659, or plasmid pRIT12329,
    pRIT10172 and grown in a liquid medium with
    lack of leucine (VNB or VNB + 80
    µg / ml histidine) followed by collection
    . cultures in the middle log phase. Cells in culture 1 or 2 ml are selected by centrifugation and suspended in 50 µl of 0.125 M Tris-HCl (pH 6.8) containing 20% glycerol, 4% SDS, 6 M urea and 10% 2-mercaptoethanol. Pos /; e incubation in
    0 for 5 minutes at 100 ° C, the sample is divided in half and both halves are subjected to electrophoresis through a 12.5% separating gel, 5% layered gel according to the Lämli method. I identify HBsAg and CS protein sequences using the immunostaining method of the protein.
    After applying the proteins to the nitrocellulose filter, the filter is preincubated for 1 hour at 37 ° C with 3%
    0 gelatin in PBS. The filter is washed successively five times for 5 minutes each time with PBS containing 0.1% Tween-20, and one half of the plate is treated for 1 hour at room temperature with a mixture of
    5 five monoclonal antibodies against CS protein in PBS 1% gelatin. The other half of the plate is treated with anti-HBsAg monoclonal antibody, Nehru TAS 12, in PBS, 1% gelatin. Filter plates are washed 5 times for 5 minutes each time with PBS, 0.1% Tween-20 and biotinylated sheep antibodies are added to IG muscles in PBS 1% gelatin for 1 hour at room temperature: ur. Plates again
    5 washed with PBS, 0.1% Tween 20.5 times for 5 minutes each time and incubated for 30 minutes at room temperature with the streptacidine-biotin-containing horseradish peroxidase (HRP) complex; Plates are washed again 3 times for 5 minutes each
    once with PBS, 0.1% Tween-20, and incubated with 30 μl of H2U2 and HRP-containing 4-chloro-naphthol, 30 mg in 10 ml of methanol, in 50 ml of PBS.
    The molecular weight of the antigens is assessed using pre-stained protein markers, ovalbumin, alphachiotrypsinogen, beta-lactoglobulin, lysozyme, cytochrome C (BRL).
    Both yeast strains DC5 and 10S 44 C transformed with pRITI2573 synthesize an antigen that reacts as with anti-CS. so with anti-HBs ad antibodies, and their molecular weight is 30,000 kilodaltons (kd). Both yeast strains DC5 and 10S 44C transformed with pRITI2574 or with pRITI2658 synthesize an antigen capable of reacting with both anti-CS and anti-HBsAg antibodies and the molecular weight of the protein is 37,000 kd.
    These results show that a hybrid protein of expected molecular weight, containing both CS and HBsAg sequences, is synthesized in yeast transformed with a plasmid containing the CS coding sequence fused to the Pre S2-HBsAg coding sequence.
    Example 12. Yeast (Saccharomyces cerevlsiae) DCS or 10S 44C strains containing either pRIT10172, pRIT12329, PRU12573 or pRIT12574 are grown in selective medium (200 ml of VNB or VNB + 80 μg / ml histidine) until the end of the log phase. Cells are collected by centrifugation and resuspended in 10 ml of 50 mM sodium phosphate buffer (pH 7.4) containing 0.5% Tween-20 (polyoxyethylene sorbitan monolaurate), 1 mmol PMS (phenylmethylsulfonyl fluoride) and 2.5% - propanol. Cells are disrupted by passing through a French press at 20,000 Psi (1.38x108 Pa). The suspension is centrifuged for 30 min at ZOOOOHD.
    The total protein concentration in the upper liquid layer (crude cell extract) is measured using bovine serum albumin as a standard. The presence of HBsAg is determined by radioimmunoassay. The presence of CS-no-sequences in HBsAg particles is tested in ELISA tests. Appropriate dilutions of samples that are tested (in PBS containing 0.2% BSA). allows you to conduct the reaction (overnight at room temperature) in the solid phase with anti-HBsAg. Bound HBsAg particles are incubated for 1 hour at 37 ° C with 1/10000 dilution (in PBS containing 0.1% BSA) of a mixture of five monoclonal antibodies, the first antibody to the CS protein, and then incubated with 1/500 dilutions (in PBS containing 0.1% BSA) biotin containing sheep anti-mouse Jg as a second antibody for 1 hour at 37 ° C. Incubated with 1/1000 dilution (in PBS containing 0.1% BSA) of the streptavidin-biotin-containing peroxy complex - Dazy horseradish and chromogen for 30 min at 37 ° C.
    Protein concentration and activity in raw cell extracts is measured. Plasmid pRIT12574 shows more than a fold less activity.
    The activity of AUSRIA in raw cell extracts is shown in Table 1.
    An ELISA experiment shows that pRIT12573 and pRIT12574 encode HBsAg and CS epitol.
    1 ml of crude cell extracts are mixed with 1.5 M CsCI in 50 mM sodium phosphate solution (pH 7.4) and centrifuged for 40 hours at 40,000 g in an ultracentrifuge. Selected fractions are tested for the presence of HBsAg and CS antigens.
    An analysis of the immunostaining of the gradient fractions confirms the results of the RIA / ELISA. HBsAg and / or CS sequences are found only in those fractions that do not react in the RIA / ELISA tests (Table 2).
    HBsAg and CS elitopes present in antigens associated with immobilized anti-HBs Ad antibodies are listed in Table 2.
    These results indicate that the hybrid protein is obtained by expressing PRIT12573 and pRIT12574. combines into particles like 22nm HBsAg particles when synthesized in yeast cells.
    EXAMPLE 13 The crude cell extract of the yeast strain 10S 44C containing pRIT12574 was clarified by precipitation with polyethylene glycol (PEG) 400 and concentrated by ultracentrifugation.
    Further purification of the hybrid particles was carried out by CsCI centrifugation, hydroxyapatite chromatography and gel filtration.
    The pRIT12574, finally purified from 10S 44C cell extract, gives one main peak on a HPZC T5K-300 column (LKV), which contains HBsAg and CS antibodies. Electrophoresis on an SDS polyacrylamide gel followed by silver staining gives one main molecular weight band of 37,000 kd. Electron microscopy data after staining with uraniate acetate give approximately the same values.
    particle size and shape as for HBsAg obtained from yeast.
    Gray yeast extracts are obtained by destroying yeast cells in the presence of an equal weight of 50 mM and sodium phosphate extraction buffer (pH 8.1), supplemented with 4 mM Titrlplex III, 1% Tween-20, 4 mM PMSF, and 10% isopropanol. Cell debris were removed by centrifugation at 11,000 g for 90 minutes, 50 ml of the centrifuged extract was adjusted to pH 7.2 with 1N. acetic acid and stirred overnight at 4 ° C in the presence of 10 g of colloidal silicon dioxide. Then the suspension is centrifuged at 3,500 g for 1 h and the resulting precipitate is washed three times with 150 ml of 0.15 M NaCI, supplemented with 2 mM PMSF and 5 mM EDTA for 15 minutes. 250 ml of 10 mM phosphate buffer (pH 9.5) containing 2% Tween-20 at 37 ° C for 3 hours are eluted. To the desorbate, the CaCl2 solution is added dropwise to the final concentration of 30 mM CaCIa and the pH is adjusted to 7. The resulting solution was left overnight at 4 ° C and centrifuged at 6500 g for 15 minutes. The supernatant is dialyzed (2x51x10 mM Tris-HCl, pH 7.1) at 4 ° C and then diluted 4 times with dialysis buffer.
    After adding 30 mM CaCIa and W NaCI, a diluted antigen solution with a pH of 7.1 is passed over a 150 ml column with phenyl-sepharose, equilibrated with the same CaCl2 (NaCI containing tris buffer with a flow rate of 30 cm / h. The column is subsequently washed equilibrated buffer until OD280 nm (optical density) is reduced to 0, and eluted at the same flow rate of 6M urea in 10 mM Tris-HCl pH 9.
    In another embodiment, the antigen solution, diluted and diluted four times, is supplemented with 20% NH4 / 2 SO / 1 (pH 7) and passed over a 150 ml column with phenyl-separose equilibrated in 10 mM Tris-HCl, pH 7.1 20% (NH4) aS04 with a flow rate of 30 cm / h. After the column was washed with an equilibration buffer, the column was eluted at the same flow rate of 10 mMtris-HC1pH7.1.
    Antigen-positive fractions are collected and finally centrifuged with one or two suitable CsCI density gradients at 4 ° C and 245000 g for 65 hours. Purified hybrid CS-HBsAg particles have a buoyant density of 1.23 g / cm3.
    PRI me R 14. Hybrid particles isolated from S.serevisiae strain 10S 44C ppI 12574, inoculant laboratory
    animals in pure form or with adjuvant aluminum hydroxide.
    Mice strain C57B1 / 6 (6-8 weeks), guinea pigs and rabbits are immunized subcutaneously and intraperitoneally at 1, 21 and 49 days. Blood is collected on the 7th, 28th, 56th and 84th day. The blood is left to coagulate at 4 ° C overnight, and the resulting serum is isolated and stored at -70 ° C until use.
    Rabbits (2 groups of 2 rabbits each) receive 10 µg of the hybrid CS-HBsAg protein in doses of 1.0 ml with or without the addition of aluminum hydroxide during each immunization. As a control, 2 rabbits were immunized with 10 μg of Vax B Nerata. Mice and guinea pigs in groups of 5 animals receive 1 and 5 μg of fusion protein, respectively, in doses of 0.5 ml for each immunization. Unimmunized animals serve as controls.
    To determine the antibody response, the serum obtained from the mice is collected for each group, while the serum from guinea pigs and rabbits is analyzed individually. Anti-C5 antibodies of tritra are measured by ELISA using recombinant CS protein P32tet32 as antigen. Anti-HBsAg titers are determined using the AUS AB kit and the WHO for comparison.
    Neither guinea pigs nor mice do not produce antibodies to HBsAg, despite repeated injections. In contrast, both animal species produce anti-CS antibodies, and this is enhanced with repetitions. An uptake of 1.0 in an ELISA assay is achieved at serum dilutions 1600 times (mice) and 9000 times (guinea pigs). The immunogenicity of hybrid particles does not increase during adsorption on aluminum hydroxide.
    Rabbits produce antibodies to both CS and HBsAg. Reverse titers at an absorption of 1.0 in an anti-CSELISA assay give values between 800 and 3200 mi / 1 ml. Anti-HBsAg titers obtained for hybrid particles adsorbed on aluminum hydroxide are between 4,000 and 20,000 mi / ml, whereas for rabbits immunized with Vax nerth, the titers range from 105 to 10 mi / ml. The adsorption of hybrid particles on aluminum hydroxide increases the immune response (Table 3).
    CSP reactivity and percent inhibition of invasion of sporozoites (% IS) HepG2-A 16 cell hematomas are given in Table 3.
    PRI me R 15. The vaccine was prepared as follows. To a buffered aqueous solution of 3% aluminum hydroxide (10 mM phosphate solution. 150 mM NaCI, pH 6.8, filter sterilized) add the obtained particles in a similar buffer with stirring to a final concentration of 100 µg / mg polypeptide and 0.5 mg / ml of aluminum (A13. pH is maintained at 6.8. The mixture is left overnight at a temperature of about 0 ° C. Thlmersol is added to a final concentration of 0.005%. The pH is checked and adjusted to 6.8.
    EXAMPLE 16 Plasmid pSTN1290 is modified by introducing a BamHI-EcoRI synthetic adapter fragment that encodes N-terminal amino acids of the pre S 2 region between TDH3 promoter APG3 terminator fragments.
    Plasmid pRIT12290 is digested with BamHI and EcoRI by enzymes and dephosphorylated by alkaline phosphatase. 20 pmol of phosphorylated synthetic adapter:
    Gin Trp BamHI 5 GATC CAG TGG3 EcoRI
    З1GTC ASSTTAA 5
    bind to 0.1 pmol of BamHI-EcoRI fragment of the dephosphorylated llazmid (pRIT1229t) using 1 unit. (and) T4 ligase, and used to transform E.coll of strain MM294. One transformant containing the target plasmid with a synthetic adapter included between the BamHI and EcoRI sites is identified.
    30 pmol (120 μg) of ptT12621 DNA is treated with 120U BamHI. After removing the restriction enzyme by phenol extraction, the plasmid is precipitated with ethanol and resuspended in an appropriate buffer for treating the BamHI strand and 280 units. (U) golden bean nucleases. The nuclease is removed by phenol extraction followed by precipitation with ethanol. The plasmid thus treated is resuspended in the ligation buffer and 10 units are recycled. T4 ligase.
    The preparation containing the cross-linked DNA is treated with phenol, precipitated with ethanol, resuspended in the appropriate buffer, and digested with EcoRI enzyme. After removal of the EcoRI site, 0.05 pmol (0.2 µg) of the DNA is suspended in a buffer (for ligation with 0.4 pmol (0.2 µg) of an EcoRI fragment of 838 bp from the pRIT12581, which contains complete G - terminal coding region of the pze S2-S protein. The pUC9 vector is cleaved with EcoRI endonuclease and treated with alkaline phosphatase, Plasmid pRIT106l6 (ATCC 39131) is cleaved with EcoR8 and A by endonucleases 826
    The EcoRI-AccI fragment containing part of pet S2-S was isolated by preparative acrylamide gel electrophoresis and electrolution. About 0.4 pmol (0.2 μg) of this fragment is mixed with about 10 pmol of the following synthetic adapter:
    No Stop Stop 5 ATACATTTAAG 3
    ACCIEcoRI
    3 TGTAATTGCTTAA 5 and the resulting mixture was treated with T4 DNA ligase and digested with EcoRI restriction endonuclease. About 90.2 µg of EcoRI endonuclease and alkaline phosphatase are added to the mixture treated in this way around the pU C vector and the resulting mixture is treated with T4 DNA ligase and used to transform competent E.coll K12 cells resistant to ampicillin.
    Colonies are examined for the presence of a plasmid containing a 2650 Lp pUC9 fragment of a vector with an EcoRI fragment of 838 Lp EcoRI, containing a 826 bp EcoRI-AccI pre S2-S fragment, together with a 12 bp Accl-EcoRI synthetic linker. The correctness of the design is verified by determining the DNA sequence.
    A mixture containing the plasmid PRIT12621 DNA and the 838 bp EcoRI fragment pRIT12581 was used to transform E.coll of strain MM294. A transformant containing a plasmid with an EcoRI fragment in the correct orientation is identified as pRIT12662.
    EXAMPLE 17 Plasmid pRIT12309 DNA was digested with a Sail endonuclease and ligated with a 2218 bp Xhol-Sall DNA fragment with the LEU 2 gene. The ligation mix is used to transform E.coll K12 cells of strain JA221.
    Plasmid pRIT12377 is identified from a colony of transformers. This plasmid contains the 2218 bp LEU2Xhol-Sall fragment, embedded in the Sail site pRIT12309,
    A Hind III fragment of 3050 base pairs from pRIT12662 encoding a pre S2-S protein, purified by acrylamide gel electrophoresis, treated with T4 half-time and ligated with pRIT12377; pre-treated with BamHI enzyme and newly crosslinked T4 polymerase. This preparation is used to transform ampicillin resistant E.Coll strain MM294.
    The plasmid pRIT12660 is used to transform two strains of S.cerevlslae, i.e. strain DS5 and strain 10S 44C cir °.
    EXAMPLE 18 The pre S2 region of the PRIT12662 plasmid is sequenced, and the atom is interchanged that there are four base pair changes that result in a change of three amino acids when compared with another adW 2 serotype virus. Alanine residue instead of threonine residue at position 45, phenylalanine instead of leucine at position 34 and serine residue instead of isoleucine residue at position 11.
    EXAMPLE 19. Yeast (S. cerevisiae) strain DC5 clr ° or 10S 44C cir ° containing plasmid pRIT12660 or plasmid pRIT12363 (example 16) is grown in a selective medium (200 ml YNB + 80 μg / ml histidine DC5 clr ° or YNB / 10S 44C clr ° and log phase). The cells are harvested by centrifugation and resuspended in 50 mM sodium phosphate, pH 8.0 with a content of 0.5% Tween-20 (polyethylene sorbitan monolaurate), 1 mM PMSF (phenylmethylsulfonyl fluoride) and 2.5% isopropanol. The cells are destroyed by passing twice through a press with a pressure of 20,000 psi (1.38 x U8 Pa). This suspension is centrifuged for 30 minutes at 30,000 d. The total concentration of protein in the supernatant (untreated cells in the extract) is determined using bovine serum as standard. The presence of material associated with HBsAg is determined using a radioimmunoassay kit (AUSRIA). The results indicate that pRIT12660 expresses a polypeptide possessing antigenic activity of HBsAg.
    In a radioimmune assay, the crude cell extracts from pRIT12660 give a positive response, whereas the crude cell extracts from pRIT12363 do not give a positive response.
    The above results show that yeast cells containing pRIT12660 express HBsAg
    AUSRIA activities in crude cell extracts are given in Table 4.
    PRI me R 20. Yeast transformed pRIT22660, grown in selective medium, either in Erlenmeyer flasks or in fermenters in the log phase and collected by centrifugation.
    To the cells (0.1 g), first, 20 µg of 40 mM PMSF in isopropanol is added. Thereafter, 200 μl of sample buffer for electrophoresis on SDS-polyacrylamide gel (0.125 M Tris-HCI, pH 6.8, containing 20% glycerol, 4% SDS, 6 M urea and 10% 2-mercaptoethanol). Samples are rotated and aliquots of 2–20 µl are further diluted in sample buffer to a final volume of 40 µl, incubated for 5 min at 100 ° C and treated electrophoretically
    After electroblotting of the proteins on a nitrocellulose filter, the resulting filters are pre-incubated for 1 hour at 37 ° C with 3% gelatin in pBS.
    The filter is incubated with anti-HBsAg monoclonal antibodies and the presence of binding is determined by sequential incubation with biotinated sheep anti-mouse Ig (dilution 1/250 in PBS,
    containing 1% gelatin), steltavidin-biotylated horseradish peroxidase complex (dilution 1/400 in PBS containing 1% gelatin) and, finally, 30 μl of Na02 and a HRP color reagent containing 4-chloro-1-naphthol , 30 mg in 10 ml of methanol is washed with PBS containing 0.1% Tween-20.
    Immunoblot gives 4 protein bands,
    associated with an S-protein of a specific molecular weight of 33, 30, 28 and 25 kd. Most of the S-bound material is found in the 33 kd protein band. The smallest detectable protein band migrates more slowly than S protein synthesized in yeast.
    EXAMPLE 21 Yeast cells are crushed in the presence of a buffer (200 mM Tris, 3 M NaCI, 10 mM EDTAa, 10 mM ethylene glycol bis (beta-aminoethyl ether) N, N, N, N-tetraacetic acid (EGTA ), 4 mM PMSF 10% isopropanol), followed by centrifugation for 45 minutes at 30,000 d
    Cell extracts of pRIT12660 are partially purified from the cell extract by ultrafiltration, CSCI equilibrium centrifugation and hydroxyapatite chromatography. 4 bands of S-linked protein material are detected at these purification steps by Western blot analysis and purified at these purification steps. The AUSRIA immunoblot analysis of positive CSCI fractions after equilibrium centrifugation shows that four S-linked bands are present in the same relative ratios in each fraction.
    PRI me R 22. Human serum albumin is polymerized by glutaraldehyde.
    processed and cleaned. Purified pR1T122660 cell lysates were separated by acrylamide gel electrophoresis and transferred to a nitrocellulose membrane. The nitrocellulose filter is successively incubated with PHS A (15 μg) ml in PBS containing 1% gelatin), antiserum of rabbit to human albumin, biotinylated anti-rabbit monkey Ig (1/250 dilution in PBS containing 1% kelatin), strepavidin-biotinated
    horseradish peroxide (1/400 dilution in PBS containing 1% gelatin) and, finally, H2O2 and 4-chloro-1-naphthol.
    The two largest S-linked protein bands (33 kd and 30 kd) are reacted with the pH of SA, and the two smallest (28 and 25 kd) do not react.
    PRI me R 23. Synthesized peptide with the following formula: NHa-Met Glu-Trp-Asn-Ser-Thr-Ala-Phe-Hls-G n-Ala-Leu-Gln-Asp-Pro-Arg-Val- Arg-Gly-Leu-Tyr-Le u-Pro-Ala, Gly-Cys-COOH. Rabbits are immunized subcutaneously with 100 μg of the conjugate (corresponding to 20 μg of peptide) in Freund's complete adjuvant, re-immunized on Day 8 and 15 with the following 10 μg of Freund's conjugate, and at 28, 69 and 149 days with 100 μg of the conjugate in PBS. The production of the antibody titer is followed by taking blood samples at regular intervals and the dilution of the serum is checked by incubating on a synthetic polypeptide fixed on a solid phase. Bound antibodies are detected with iodinated protein A. Serum is used after 100-fold dilution or after partial purification of IgG, IgG is partially purified by precipitation with NaaSO4 (120 mg per 1 ml of serum), resuspended in PBS, and 14% N32S04 are reprecipitated. The resuspended Ig solution is desalted by passing through a PD 10 column.
    Determination of the reactivity of proteins in immunoblots was carried out using biotinylated anti-krin Ig monkeys, streptavidin-biotinated horseradish peroxidase and H20a and 4-chloro-1-naphtol.
    Proteins from partially purified pRIT12660 preparations were isolated by SDS polyacrylamide gel electrophoresis and transferred to nitrocellulose. The immunoblot showed that two larger protein bands (33 kd and 30 kd) react with antibodies.
    EXAMPLE 24 A partially purified preparation is dissociated by SOS and proteins are separated by acrylamide gel electrophoresis. After transferring proteins to nitrocellulose, the resulting membranes are incubated with hepatitis B containing 1% gelatin tenfold with diluted gamma globulin. Antibody binding was determined by sequential incubation with sheep biotinylated anti-human Ig (1/250 dilution in PBS containing 1% gelatin), horseradish streptavidin-biotinylated peroxidase, and finally. Ng02 and 4-chloro-1-naphtol.
    The two largest protein bands (33 and 30 kd bands) are subjected to interaction with human antibodies, the two smallest (28 and 25 kd bands) do not give 5 reactions. S protein derived from particles from yeast cells containing pRIT12363. does not interact with these human antibodies.
    0 EXAMPLE 25. Pre S2-S protein from partially purified preparations of particles from pRIT12660 containing 10S 44Cclr ° cells is separated by electrophoresis and transferred to nitrocellulose. Run on gel S
    5 Protein purified from yeast containing pRIT12363 and HBsAg particles from serum of infected people. 1/2 nitrocellulose filter incubated in 50 μg / ml concanavalin A in 10 mM Tris pH
    0 7.5, 150 mM NaCl. 1 mM CaChz, 1 mM MnCfe. 0.05% Tween-20 and then 30 µg / ml horseradish peroxidase in YumMtrisrN 7.5,150 mM NaCI, 0.05% Tween-20, and finally 4-chloro-1-naphthol.
    5 Between the incubations, the filter is washed with 10 mM Tris pH 7.5, 150 mM NaCI. 0.05% Tween-20. The other half of the nitrocellulose filter is incubated with monoclonal antibody 6.
    0 A 33 kd protein band reacts with N-peroxidase reagents with cocanavaline, although none of the 30, 28, 25 kd protein bands from yeast cells containing pRIT12363 react. In the presence of 0.1
    5 M methyl-alpha-O-mannopyranoside does not bind concavaline A with 33 kd protein.
    Example 26. Cells containing with PRIT12660 and pRIT12377 are grown in a selective medium (YNB + 80 g / ml histidine / DCS clr ° or YNB / 10S 44C clr0 to a value of 00b20pm 0.2. Tunicamycin is added to final concentration of 10 / l g / ml and culture incubated for 3 min at 30 ° C.
    5 Then 20 fin CI S-methionine (1000 Cl / mmol) per 1 ml of the mixture is added and the cultures are incubated for another 15 minutes. A labeled 2 ml cell culture, treated or untreated with a tunic, was centrifuged in a microfuge and the compressed cells were resuspended in 40/1% SDS, after which they were destroyed by mixing in a mixer for 2 minutes in the presence of 0.3 g of glass balls (diameter 0.45-0.50 mm).
    Conducted immune deposition. The lysate is heated for 3 minutes at 100 ° C, diluted with 0.5 ml of PBS containing 1x Triton X100, 0.5% deoxycholate 0.1% SDS, and heated again for 1 minute at 100 ° C.
    25 ml of a 10% suspension of pre-washed immunoprecipitin is added to the boiling extract and the system is incubated for 30 minutes at 0 ° C. The resulting mixture was clarified by centrifugation for 5 minutes on a microfuge. 2.5 ml of monoclonal antibody 6 specific for S protein is added to the upper layer of the liquid and the mixture is incubated for 1 hour at 0 ° C. Then another portion (25 ml) of immunoprecipitin is added and the mixture is incubated for 30 minutes at 0 ° C. The immune complexes are collected by centrifugation (5 min in a microfuge) and washed with PBS containing 2 M urea, PBS containing 1% 2-mercaptoethanol, and finally with PBS. The finally washed granules are re-suspended in the buffer solution.
    Samples containing 105cPt are subjected to electrophoresis through a 12.5% SDS polyacrylamide gel. After electrophoresis, the gels are fixed in a 40% methanol solution of 10% acetic acid, treated for fluorography, dried on filter paper under vacuum, and subjected to fluorography using a film at 70 ° C.
    The result showed that yeast cells containing pRIT12660. 33 kd protein is synthesized in the absence of tunicamicin and 30 kd protein in the presence of tunicamycin. Both bands are absent in the corresponding cell samples containing pRIT12377.
    The results show that the 33 kd pre S2-S protein expressed in yeast strains D65 c1r ° bears the oligo-saccharide part, M-glycoside-linked asparagine.
    EXAMPLE 27 Oligosaccharide Structure.
    Raw cell extracts of cells containing pR T12660 or partially purified preparations containing pre S2-S particles from such extracts are treated with endo-M-acetylclucosamimidase from Streptomyces plicatus.
    Partially purified particles (50 ml, 450 mg / ml protein) are boiled for 3 min at 100 ° C in the presence of 0.1% sodium dodecyl sulfate, diluted 10 times with 100 M sodium citrate with a pH of 5 and 240 ml of this mixture was added 2.4 ml of endo H (74 mg / ml). Samples containing and not containing endo H are incubated for 2 hours at 37 ° C. Analysis of samples treated and not treated with endoH is performed using
    SDS-polycrylamide gel electrophoresis and immunostaining with detection of mono: clonal antibody 6 to protein S. made it possible to establish the disappearance of the band,
    33 kd, and the appearance of the 31 kd band during endo H treatment. The 31 kd band continues to react with concanavalin A-peroxidase reagents. The position of the other bands (30, 28 and 25 kd) does not change.
    during the treatment of endo N. Similar results are obtained with longer incubation or at higher concentrations of endo N.
    Example 28. A crude yeast extract containing pre S2 S particles is prepared by grinding the yeast cells in the presence of an equivalent weight amount of extraction buffer, which is 50 tM sodium phosphate with a pH of 8.1 4 tM EDTA, 1.0% Tween-20, 4 mM PMSF and 10% isopropanol or 200 mM Tris-HCl with pH 9.0, 3.0 M NaCI, 10 mM EDTA, 10 mM EGTA (ethylene glycol-bis- (beta) -amino ethyl ester N, N, N, N -tetraacetic acid), 1% Tween-20, 4 mM PMSF and 10% isopropanol.
    The pH of the homogenate is set to 8.0 or 9.0, respectively, and after that
    centrifuged for 45 min at ZOOOOHD.
    To 500 ml of crude yeast extract with a pH of 7.2, 10 g of colloidal silica was added.
    The colloidal suspension is stirred overnight at 4 ° C and then centrifuged at low speed of rotation, the granules are washed three times with 150 ml of 0.15 M NaCl solution for 1/4 h and then periodically eluted with 250 ml of 10 mM pyrophosphate buffer (pH 9 , 3), containing 2% Tween-20. the reaction is carried out for 3 hours at 37 ° C. Desorbate, which is a yellowish, brightly opalescent
    the solution is passed through a 50 ml column with a phenylboronate gas and equilibrated with a 10 mM pyrophosphate buffer at pH 9.0. Flow rate 15 ml / h. Column additionally washed 2
    volumes of equilibration buffer and then elute in the opposite direction with 100 mM sorbitol 0 50 mM tris (pH 7.2) at a flow rate of 15 ml / h. The eluted target fractions are drained and, after adjusting the pH to 8.1, are passed through a TSA DEAE-Fractogel column, equilibrated with a 50 mM Tris solution with a pH of 8.2. The particles are eluted with the same buffer containing 75 mM NaCI. After this stage, the remaining nucleic acids (up to 1 µg / 20 µg protein) are removed.
    The results of the material balance are presented in table.5.
    A material was purified from extracts of yeast cells containing pRIT12660, followed by unbalanced centrifugation in the presence of CSCI, after which this material was examined by an electron microscope after staining with uranyl acetate. As a result of this study, the presence of structures of discrete particles with a diameter of 19 µm is detected, and it is established that the content of such hybrid particles is 5-20 µg of Toin-20 per 100 µg of protein.
    PRI me R 29. Aerosil-desorbate in an amount of 50 ml is passed through a 5 ml column with lentil agarose equilibrated with an equilibration buffer (Tris buffer) in an amount of 10 tM (pH 7.2). 0.14 MNaCI and 0.3% Tween. The column is washed with two volumes of equilibrating buffer of 10 gpm (pH 7.2) and then eluted with sugar with lentil specificity, such as 0.5 M alpha methylmannopyranoside in equilibrium buffer.
    The results of the material balance are presented in table.6.
    As a result of the study, it was established that hybrid particles contain 5-50 µg of Tween-20 per 100 µg of protein.
    PRI me R 30. Immunogenicity of particles obtained from cell extracts containing pRtT12660. study on two strains of mice: Balb / c (Ha-d) and NMRI (Na-O). Before injection, the particles are adsorbed on AI (OH} 3 and mice (5 mice per group) intraperitoneally injected with 0.3 µg RIA of the reactant material. 1 month after immunization, the mice are killed, the blood is drained and the serum of the mice of the same group is drained. The antibody titer to the S-protein in the preparations obtained is determined using the AUSAB kit (Abbot Labe) and the WHO standard, antibodies to the per-S2 peptide are determined using a solid phase assay (RIA), according to which the synthetic prie S2 peptide is absorbed onto plastic and bound antibodies are detected by an ant and the mouse IgG codon labeled with the 1251 isotope. The results in Table 7 show that extracts of yeast cells containing pRIT12660 induce anti-S rge S2 antibodies in both strains of mice, and in mice of the NMRI strain induce higher titers of anti -rge S2 antibodies than mice of Balb / c strain. Antibody titer to S protein obtained from mice
    Balb / c strain or NMRI is 2-3 times higher than the titer obtained at a higher dosage from yeast cells containing pRIT12363.
    The results of the study of immunogenicity related to the Pge S2-S particles are summarized in Table 7.
    The titer is a dilution that provides significant antibody binding (2.5 times the value obtained on a negative control serum).
    EXAMPLE 31. The first stage is the fusion of a TDN3 promoter region with a pi SIN-terminal region of the HBV genome. The starting material is a plasmid pRIT12792 containing the Ncol-Xbal fragment of 495 LP with the S1-Pre S2 coding sequence with the exception of the last aspartic codon.
    Both fragments of Ncol-Xbal are contained on pRIT12792 and pRIT12793. They are obtained from pge S1-pre S2 DNA of the hepatitis B virus strain (ddw serotype) cloned on the plasmid pRIT10616.
    PRIT12792 in an amount of 52 µg is hydrolyzed in the presence of Ncol and Xbal endonucleases and treated with bean nuclease in order to eliminate 5 branches. The processed and purified 495 bp Ncol-Xbal fragment in the amount of 600 pg (2 pmol) is ligated with 170 pg (0.02 pmol) of the pRIT12314 vector, previously linearized using Bam HI and Smal endonucleases. m is treated with “bean cleavage pRlT12314 contains a complete 2 micron fragment of S.cerevlslae and a TDNZ promoter, separated from the BALH terminator BamHI-Smal-EcoRI linker,
    BamHIEcoRI
    Smal
    ATGGATCCCCCGGAATC rTDNztARCs
    The ligation mixture is used to transform E.coll MM294. Six transformants containing a plasmid are selected in which the S1-pre S2 fragment is inserted in the correct orientation. The plasmid pRIT12843 (a ... f) is obtained.
    The next stage consists in introducing into each of the pRIT 12843 (a ... f) S plasmids of the coding region in order to rearrange the entire prec-S1-S2-S gene.
    This operation is carried out as follows.
    Each of the pR IT 12843 plasmids (a ... f) is hydrolyzed in the presence of BamHI and Salt restriction enzymes. The BamHI site is placed at the beginning of the pre-S2 site, while the Salt site is placed
    after the APG3 terminator in pBR 327. The largest BamHI-Sall fragment (10,400 bp) in an amount of 80 pg (0.012 mmol), purified from the pRIT12843 plasmid (a. f), is ligated from 300 pg (0.11 pmol) of the fragment BamHI-Sall from PRIT12660 4800 Lp, the BamHI-Sall fragment pRIT12660 contains the pre S2-S part of the coding sequence, followed by the APG-terminator sequences and the IEY2 yeast sequence. After ligation and transformation of the E.coll strain MM294, plasmids pRIT12843 (a ... f) are selected for each of the plasmids named pRIT12845 (a ..f). Such plasmids pRIT12845 (a ... f) are used for transformation S .cerevislae strain 10S 44С cir °. Screening of cultures grown from individual clones by transformation of yeast was carried out by testing raw cell extracts in the AYS RIA kit. Crude cell extracts are prepared by disrupting yeast cells resuspended in PBS containing 0.5% Tween-20, 2 mM PMSF and 5% isopropanol. One transformant was tested from each of the six individual transformations in the presence of pRIT12845 (a .., f). Five of the six transformants tested tested positive for AYS RIA.
    Samples of raw extracts are subjected to immunological research. Four of the five transformants with a positive reaction when tested AYS RIA detect S-related protein ZEK. One transformant exhibits a related protein at 23 K.
    EXAMPLE EXAMPLE 32 is prepared cherye cellular extracts from a yeast strain 10S 44C cir °, containing pRIT12845, pRIT12660 or pRIT12377, yeast strains and extracts from strain 10S 44C clr °, containing pRIT12843 and pRIT12660, show a strong antigenic activity of HBsAg, which is absent in extracts from a 10S 44C cir ° strain containing pRrT12377 or a clr ° strain DS5 containing pRIT12363.
    Centrifugation of crude cell extracts from 10S 44C cir ° cells containing pRIT12845 and measurement of HBsAg antigenic activity by AYS RIA methods in CSCI fractions allowed detection of an antigen with a bandwidth of about 1.2 g / cm rho. The activity of CSCI fractions with respect to binding to pre S1 antibodies is tested by EL ELISA. After the antigen is bound to the solid-phase anti-HBsAg, it is incubated in the presence of the monoclonal antibody MA18 / 7, which is then detected using biotinylated anti-mouse Ig, anti-horseradish peroxidase and chromogen.
    The results show that the pre S1-pre 52 protein produced in 10S 44C clr ° cells containing pRIT12845 accumulates in the particles, similarly to the HBsAg particles obtained from serum,
    PRI me R 33. HBsAg is analyzed for related protein monomers expressed in cells containing PRIT12845.
    The migration and immune reactivity of cellular proteins is compared to proteins from HBsAg particles purified from human serum.
    Three immunoreagents are used for protein analysis: - monoclonal antibody to S epitope, - polyvalent rabbit antiserum and pre S2 peptide, - monoclonal antibody MA18 / 7 specific for the pre S1 epitope.
    An immuno-blot analysis showed the presence of two proteins among the cellular proteins of 10S 44C pRIT12845 cells, specifically reacting with the three immunoreagents described above. The molecular weight of two such proteins is determined to be 38,000 and 45,000 daltons, the pre S1-pre S2-S protein weighing 38,000 daltons migrates somewhat faster than the p39 pre S1-pre S2-S protein from HBsAg particles.
    These results show that yeast cells containing a pH of 12845 express two proteins weighing 38 and 45 kd carrying pre S1. pre S2, as well as S-epitop1.
    Example 34 Yeast cells containing pRIT12845 are destroyed by glass beads, taken at an equivalent weight (diameter 0.45-0.50 mm), at an equal weight of 10 mM sodium phosphate buffer (pH 7.4). containing 2% SDS and 8 mM EDTA, as a result of mixing in a mixer.
    After centrifugation, the upper layer is heated at 100 ° C for 4 minutes.
    A 10 µl liquid from the heated upper layer was diluted with 40 µl of 25 mM sodium citrate buffer (pH 5.0) and 2 µl of EndoH (74 µg / ml) was added. Samples containing and not containing added EndoH are incubated for 2.5 hours at 37 ° C.
    Samples that were treated and not treated with EndoH were analyzed by electrophoresis on an SDS-polyacrylamide gel and immuno-blotted.
    The patch is analyzed with monoclonal antibody 6 MA18 / 7.
    In accordance with the analysis by the method of immuno-blotting, both in the case of monoclonal antibody 6 and monoclonal antibody MA18 / 7, the disappearance of the band corresponding to 45 kd and the appearance of the band of 41 kd during the EndoH treatment are observed. EndoH processing does not affect the migration of the 38 kd band.
    These results show that the pre S1-pre S2-S proteins with a molecular weight of 45 kd carry the high mannose type N-glycoside-linked oligosaccharide chain.
    Example 35. Yeast strain 10S 44C cir ° cells containing pRIT12845, pRIT 12660, or pRIT12377 are grown in YNB to an OD620 nm value of about 0.4.
    Cells (20 ml of culture) are labeled for 60 min. ImCI 3H-labeled myristic acid and then harvested by centrifugation. The resulting cells are washed with cold HgO, resuspended in 100 ml of 3 mM Tris-HCl (pH 7.4) containing 3 mM (DTT). 1% SDS and 1 mM PMSF, and destroy 100 mg of glass beads as a result of six 30-second intensive mixing stages in a mixer, with ice cooling before each stage. Debris is removed by centrifuging for 1 min in a centrifuge. The extract in an amount of 20 μl is treated for 3.5 hours at room temperature with 7 μl of freshly prepared 4 M hydroxylamine, 20 M glycine, pH 10.
    Samples treated and not treated with hydroxylamine are subjected to electrophoresis on SDS polyacrylamide gel. Samples not treated with hydroxylamine are subjected to immunoblot analysis in the presence of a monoclonal antibody that recognizes the S epitope.
    Using fluorography, it is established that the labeled band, corresponding to 38 kd, is present only in the cell extract of yeast cells containing pRIT12845. Labeled bands specific for extracts from cells containing pRIT12550. do not detect.
    These results indicate that the pre S1-S2-S protein, weighing 38 kd, contains a covalently bound myristic acid present in the amide bond. As a rule, myristate covalently binds to proteins through an amide bond to the amino terminal glycine. This fact suggests that the initiating code for Met is removed from the pre S1 pre S2-S protein and that the Gly residue at position 2 is available for acylation with myristic acid.
    EXAMPLE 36. The plasmid pRIT12793 contains the pre S 1-rge S2 coding sequence on an Ncol-Xbal fragment of 495 Lp. The plasmid pRIT12793 DNA is hydrolyzed in the presence of the Ncol endonuclease, treated with T4 DNA polymerase to fill sticky ends, and then hydrolyzed in the presence of Xbal endonuclease. The Ncol / T4 DNA polymerase / Xbal fragment was purified by polyacrylamide gel electrophoresis and electroelution and inserted into the pYC12 vector pretreated with Smal and Xbal endonucleases. The only Bst X site is present at the N-terminus of the pre-SI coding region.
    Exogenous coding DNA sequences can be introduced by hydrolyzing pRITX.n of its derivatives with Bst X and BamHI or EcoRI or Pst I endonucleases and inserting this coding sequence between these sites, resulting in the removal of most of the pre SI coding region and the N-terminal - Noah part of pre S2 sequence. After producing such constructs, they can be recombined into other plasmids containing the pre S 1-pre S2 residue sequences necessary for preservation and replication in E. coll and S. cerevl clae.
    From these HIY genomic clones of the virus, various subfragments are obtained, such as pre S2-S DNA coding sequences. Such hybrid particles serve as the primary vaccine to protect people from the HIY infectious agent.
    The starting material is a plasmid pBH10-R2 containing the HIY gene of isolate BH10. The 3108 bp Sall-Xhol DNA fragment of viral origin is cut out from pBH10-R2 and cloned between the Sail and Xhol sites of the plasmid pYC18 and the plasmid pRIT12901 is obtained.
    The pRIT12901 DNA is hydrolyzed with Bglit and Mboll endonucleases and a fragment of 117 Lp is separated by electrophoresis on an acrylamide gel and electroelution. The DNA of the fragment is treated with bean nuclease in order to remove single-stranded branches and ligate with the pRIT10911 DNA, which is digested with the BamHI endonuclease and treated with the bean nuclease. From the ligation mixture, plasmid pRlT12893 was isolated, in which a Bglll-Mboll fragment of 117 Lp in size from pRIT12901 was inserted into pRIT10911. The nucleotide sequence of the TDNZ of the protomore, fused to the HTIY-III Bglll-Mboll fragment of 117 Lp is determined. It is established that such a sequence has the form:
    5 ATCCACCAGGACATATCACCCA 34
    where the first ATG codon is the TNZ fragment of the pRIT10911 promoter region, and the second group is the internal ATC of the Codo C7 peptide fragment. The second ATC codon overlaps the TGA terminal codon. This termination codon is in the same reading frame as the first ATC codon. DNA sequence sequencing at 3 sites on pRIT12893 allowed the correct fusion sequence to be processed by nuclease of the Mboll end of the HTIY / III fragment with the pre S2 sequence on pRIT10911.
    The pRIT12893 DNA is then processed in the presence of the Hind III endonuclease and a 3250 Lp fragment is isolated, which is purified by electrophoresis on an agarosagel and electroelution. Then a 3250 bp Hind III fragment was inserted into the Hjnd III site of the plasmid YEp13 in order to obtain pRIT12894. Plasmid DNA is used to transform cells of the yeast strains DS5 and 10S 44C.
    Transcription and transcription in C7 yeast cells of the fusion -pre S2-S protein DN K to pRIT12894 results in a 5 residue synthesis of the peptide starting from the TDN3 codon, as well as the C7-rge 52 fusion peptide starting at the second internal ATC codon C7 sequences. This fusion contains 38 amino acid residues of the C7 peptide instead of 45 residues.
    intact Bglll-Mboll - nuclease-treated C7 bean fragment.
    The pRIT12901 DNA is hydrolyzed in the presence of the Hhal and Hind III endonucleases, and a 230 Lp fragment is isolated. This fragment is purified by acrylamide gel electrophoresis and electroelution and treated with DNA polymerase to fill
    single-stranded branches. The fragment thus treated is ligated again with pRIT10911 DNA, which is treated with BamHI and bean nuclease. Plasmid is identified from the ligation mix.
    pR T12897, into which a HIY DNA fragment of 230 Lp is inserted in the correct reading frame to be fused to the pre S2 sequence pRIT10911. Then the plasmid DNA pRIT12897 is hydrolyzed with
    The Hind III endonuclease and the 3365 Lp fragment containing the TDNS promoter, HIY-pre S2-S, APG3 terminator, are purified by agarose gel electrophoresis and electroelution. This 3365 LP fragment
    Ligated with the plasmid YEp13 hydrolyzed with Hind III endonuclease and get PRIT12898. Plasmid DNA (pRIT12898) is used to transform cells of the yeast strains DS5 and 10S 44C.
    A 60 bp synthetic DNA fragment is synthesized by traditional methods in the form of two single strands, which are then subjected to joint renaturation:
    5 GATCTCGACAGGCCCGAA GGAATAGAAGAAGAAGGTGGAGAGAGAZ1
    3 AGCTGTCCGGGCTTCCTTATCTTCTTCTTCCACCTCTCTC5
    5 GACAGAGAGAGATCCCCG3 3 CTGTCTCTGTCTAGGGGCCTAC5
    This fragment has 5 Bglli and 3 BamHI single-stranded ends. About 20 g of the double-stranded fragment and 300 pg of the plasmid pRIT10911 DNA treated with BamHI are mixed and ligated. The lasmid pRIT12898 is identified, isolated and a 60 lp fragment is inserted into it at the BamHI PRIT10911 site. The pRIT12899 DNA is hydrolyzed with a Hind III endonuclease and the Hind III fragment of 3,200 Lp is purified by agarose gel electrophoresis and electroelution. The Hind III fragment is inserted onto the Hind III site of YEp13, and plasmid pRIT12900 is obtained. The plasmid pRIT12900 DNA is then used to transform the yeast strains DS5 and 10S44C
    PRI me R 38 Yeast strains DS5 or 10S 44C containing YEp13. pRIT10912,
    pRIT12894 or pRIT12898, grown in a liquid medium that does not contain leucine (YNB + 80 μg / ml histidine or YNB) and the cellular proteins are analyzed by the method
    immunoblot using monoclonal antibody to human HBsAg epitope as the first antibody. pRIT12894, pRIT12363 carries the HBV S gene fused to the TDN3 promoter as a 2900 Lp Hind III fragment from pRIT12322 embedded in a yeast vector plasmid identical to the pRIT12377, and produces HBsAg under the control of the TDNZ promoter. Immuno-blotting detects the band
    S-related protein with a molecular weight of about 32 kd among the total cellular proteins from yeast strains DS5 or 10S 44C transformed with pRIT12894. The band attributed to S protein with a molecular weight of about 45 kd is present among the total cellular proteins from the yeast strains DS5 or 10S 44C. containing pRIT12898, while the band relative to protein S of molecular weight on the order of 29 kd is present among cellular proteins from the yeast strain DC5 containing pRIT10912.
    Prepare raw cell extracts from a yeast strain DS5. containing either pRIT12363, pRIT10912 or pRIT12894. Protein concentration and activity are measured by AYS RIA. These extracts are analyzed by immunoblotting.
    CSCI centrifuging the raw extracts and measuring HBsAg antigenicity using the AYS RIA method in CSCI fractions allows detection of an antigen corresponding to
    a band of about rho 1.2 g / cm3. This result is confirmed by immuno-blotting CSCI fractions.
    权利要求:
    Claims (1)
    [1]
    Yeast cells of strains DS5 and 10S 44C transformed with either pRIT12894 or pRIT12898 synthesize a fusion protein with a molecular weight of about 32 and 45 kd, both of which carry S ettopes. Claims of the method of producing a hybrid polypeptide containing HBsAg, involving the construction of recombinant plasmid DNAs encoding the fusion polypeptide, transforming the obtained DNA of Saccharomyces cerevislae strains, isolating and purifying the target product, which is based on the design of recombinant plasmid DNA synthesis DNA or pRIT12574. transform S.cerevlsiae 1044C or DS5 strains.
    Table 1
    table 2
     Glycosylated is not enough to hold onto the column.
    Table 3
    Table 4
    Table 5
    Table 6
     The determination is carried out using AYS RIA. The determination is carried out using the AVS AB kit. The determination was carried out using solid state radiation immunoassay and a synthetic pre S 2 peptide adsorbed onto plastic.
    Table 7
    类似技术:
    公开号 | 公开日 | 专利标题
    SU1746887A3|1992-07-07|Method for preparation of hybridous polypeptide, containing hb@a@
    US5792463A|1998-08-11|Hybrid particle immunogens
    EP0175261B1|1991-12-11|Hybrid particle immunogens
    Ståhl et al.1989|A dual expression system for the generation, analysis and purification of antibodies to a repeated sequence of the Plasmodium falciparum antigen Pf155/RESA
    JP2665359B2|1997-10-22|Purification method by immunoaffinity
    EP0307472B1|1992-09-30|Immunogenic recombinant yeast expression product and method forpurifying it
    HU196625B|1988-12-28|Process for producing hepatitis b virus vaccine
    KR940001712B1|1994-03-05|Peptide with a characteristic antigenic determinant for alpha 1-microglobulin
    JP2001517091A|2001-10-02|Antigenic compositions and methods for detecting HELICOBACTER PYLORI
    Martinez-Donato et al.2007|Multimeric HCV E2 protein obtained from Pichia pastoris cells induces a strong immune response in mice
    EP1315517A1|2003-06-04|Mimetic peptides for epitope of apolipoprotein b-100, concatemer and modified peptides thereof, and the vaccine composition comprising the same
    CA2006587C|2000-01-18|Membrane proteins and peptides of haemophilus influenzae type b
    STOWERS et al.1995|Immunogenicity of recombinant Plasmodium falciparum rhoptry associated proteins 1 and 2
    Leith et al.1984|Purification of a Mycoplasma pneumoniae adhesin by monoclonal antibody affinity chromatography
    Atsuhiko et al.1982|A glycopeptide containing 15 amino acid residues derived from hepatitis B surface antigen particles: demonstration of immunogenicity to raise anti-HBs in mice
    US4997647A|1991-03-05|Vaccine against the sporozoite stage of malaria
    NZ226025A|1991-10-25|Plasmodium falciparum merozoite epitope peptides, peptide conjugates, dna and antibodies
    WO1988007546A1|1988-10-06|Immunogenic polypeptide and method for purifying it
    BG61700B1|1998-03-31|Hbv surface proteins with reduced host carbohydrate
    Kim et al.1995|Efficient expression, purification and characterization of hepatitis B virus preS1 protein from Escherichia coli
    Green et al.1996|Construction, purification and immunogenicity of antigen-antibody-LTB complexes
    US5225534A|1993-07-06|Recombinant malarial polypeptides
    WO1989005825A1|1989-06-29|EXPRESSION OF RECOMBINANT 18/16.6 AND 15.2 kD PROTEIN ANTIGENS OF MYCOBACTERIUM LEPRAE
    Rhyum et al.1994|High level expression of hepatitis B virus preS1 peptide in Escherichia coli
    Randall et al.1994|Purification of antibody—antigen complexes containing recombinant SIV proteins: comparison of antigen and antibody—antigen complexes for immune priming
    同族专利:
    公开号 | 公开日
    KR880009130A|1988-09-14|
    DD285994A5|1991-01-10|
    DD284899A5|1990-11-28|
    DK43188A|1988-07-31|
    OA08801A|1989-03-31|
    DD285612A5|1990-12-19|
    TNSN88004A1|1990-07-10|
    FI880428A0|1988-01-29|
    MA21169A1|1988-10-01|
    PT86640A|1988-02-01|
    NO880395D0|1988-01-29|
    AP8800078A0|1987-11-01|
    FI880428A|1988-09-13|
    JPS6463382A|1989-03-09|
    HUT50876A|1990-03-28|
    DK43188D0|1988-01-28|
    CN1031395A|1989-03-01|
    NZ223297A|1991-06-25|
    NO880395L|1988-08-01|
    YU17488A|1991-02-28|
    PT86640B|1992-01-31|
    EP0278940A3|1988-12-07|
    IL85216D0|1988-07-31|
    AU1093088A|1988-08-04|
    EP0278940A2|1988-08-17|
    ZA88488B|1988-10-26|
    AP56A|1989-09-26|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    AU584580B2|1982-09-08|1989-06-01|Smith Kline - Rit|Hepatitis B virus vaccine|
    GB2145092B|1983-01-28|1988-04-07|Univ New York|Protective peptide antigen|
    DE3585578D1|1984-06-18|1992-04-16|Chiron Corp|HEPATITIS SURFACE ANTI-PARTICLE VACCINE.|
    EP0401941A3|1984-07-11|1991-04-17|Takeda Chemical Industries, Ltd.|Hepatitis b virus surface antigen and production thereof|
    GB8421282D0|1984-08-22|1984-09-26|Connaught Lab|Multispecific antigenic proteins|
    DE3584866D1|1984-09-12|1992-01-23|Chiron Corp|HYBRID PARTICLE IMMUNOGENES.|
    EP0180012A1|1984-10-27|1986-05-07|Wolfram H. Prof. Dr. Gerlich|Immunogenic polypeptide sequence of hepatits B virus|
    CN86100979A|1985-02-07|1986-12-17|史密丝克莱恩贝克曼公司|The preparation method of malaria vaccine|
    US4774175A|1985-03-01|1988-09-27|Centocor, Inc.|Immunochemical methods for the detection of antibody against HTLV-III|
    US4683294A|1985-04-03|1987-07-28|Smith Kline Rit, S.A.|Process for the extraction and purification of proteins from culture media producing them|
    WO1986006077A1|1985-04-08|1986-10-23|Amgen|A method and a hybrid promoter for controlling exogenous gene transcription|
    FR2581394B1|1985-05-02|1988-08-05|Grp Genie Genetique|PARTICLES HAVING IMMUNOGENIC PROPERTIES OF THE HBS ANTIGEN AND CARRYING A FOREIGN ANTIGENIC SITE TO THE EPITOPES CARRIED BY THE HBS ANTIGEN, ANIMAL VECTORS AND CELLS FOR THE PRODUCTION OF SUCH PARTICLES AND COMPOSITIONS CONTAINING SUCH PARTICLES FOR THE PRODUCTION|
    US4816564A|1986-01-31|1989-03-28|Merck & Co., Inc.|Method for producing hepatitis B virus proteins in yeast|
    CA1310602C|1986-06-03|1992-11-24|Hajime Horii|Yeast promoter and process for preparing heterologousprotein|IL86833D0|1987-06-22|1988-11-30|Medico Labs|Peptide containing immunogenic particles|
    NZ228774A|1988-04-25|1991-05-28|Phillips Petroleum Co|Hbv particles containing pres 2 proteins and recombinant processes for their production in yeast cells|
    EP0345792A3|1988-06-10|1991-05-02|F. Hoffmann-La Roche Ag|Htlv-i / hiv-1 fusion proteins|
    FR2635532B1|1988-07-29|1992-05-22|Pasteur Institut|HYBRID RECOMBINANT HBSAG PARTICLES: MORPHOLOGICAL CHARACTERISTICS OF THE HBSAG ANTIGEN CONTAINING 1 IMMUNOGENIC SEQUENCE INDUCING NEUTRALIZING ANTIBODIES DIRECTED AGAINST HIV OR LIKELY TO BE RECOGNIZED BY SUCH ANTIBODIES; NUCLEOTIDE SEQUENCES ENCODING FOR SUCH PARTICLES; VACCINES CONTAINING THEM|
    US5130247A|1989-09-19|1992-07-14|Merck & Co., Inc.|Expression of fusion protein of HIV envelope and HBsAG|
    EP0421626A1|1989-09-19|1991-04-10|Merck & Co. Inc.|Vaccine for aids and hepatitis B|
    US5130248A|1989-09-19|1992-07-14|Merck & Co., Inc.|Expression of fusion protein of HIV envelope and HBsAg|
    EP0491077A1|1990-12-19|1992-06-24|Medeva Holdings B.V.|A composition used as a therapeutic agent against chronic viral hepatic diseases|
    JP3954643B2|1991-11-16|2007-08-08|グラクソスミスクライン・バイオロジカルス・ソシエテ・アノニム|Hybrid protein between CS and HBsAG derived from Plasmodium|
    WO1993013120A1|1991-12-23|1993-07-08|Chiron Corporation|Hbv amplifier probes for use in solution phase sandwich hybridization assays|
    US6297048B1|1992-02-04|2001-10-02|Chiron Corporation|Hepatitis therapeutics|
    US5928902A|1992-02-27|1999-07-27|Smithkline Beecham Biologicals |Hybrid protein between CS from plasmodium and HBsAg|
    US6169171B1|1992-02-27|2001-01-02|Smithkline Beecham Biologicals |Hybrid protein between CS from plasmodium and HBSAG|
    US6667387B1|1996-09-30|2003-12-23|N.V. Innogenetics S.A.|HCV core peptides|
    US6709828B1|1992-03-06|2004-03-23|N.V. Innogenetics S.A.|Process for the determination of peptides corresponding to immunologically important epitopes and their use in a process for determination of antibodies or biotinylated peptides corresponding to immunologically important epitopes, a process for preparing them and compositions containing them|
    PT891982E|1992-03-06|2007-07-27|Innogenetics Nv|Hiv peptides|
    WO1993020840A1|1992-04-14|1993-10-28|British Bio-Technology Limited|Induction of ctl responses|
    KR100287083B1|1992-05-23|2001-04-16|장 스테판느|Combination vaccine comprising hepatitis B surface antigen and other antigens|
    CN1063343C|1993-04-27|2001-03-21|中国科学院上海生物化学研究所|Hepatitis B surface antigen protein having ammonia end with pre-surface antigen determinant|
    US6235888B1|1994-10-05|2001-05-22|The General Hospital Corporation|Hepatitis C virus vaccine|
    RU2189254C2|1995-06-06|2002-09-20|Америкэн Хоум Продактс Корпорэйшн|Vaccines against hepatitis viruses|
    WO1997038087A2|1996-04-05|1997-10-16|Chiron Corporation|Alphaviral vector with reduced inhibition of cellular macromolecular synthesis|
    EP1860192A1|1996-09-17|2007-11-28|Novartis Vaccines and Diagnostics, Inc.|Compositions and methods for treating intracellular diseases|
    GB9623233D0|1996-11-07|1997-01-08|Smithkline Beecham Biolog|Vaccine composition|
    CN100558401C|1998-10-16|2009-11-11|史密丝克莱恩比彻姆生物有限公司|Adjuvant system and vaccine|
    CN1468256B|2000-08-10|2010-10-27|史密丝克莱恩比彻姆生物有限公司|Purification of HBV antigens for use in vaccines|
    CN100381171C|2004-12-30|2008-04-16|成都生物制品研究所|Composite hepatitis B virus surface antigen granule containing S1, S2 and S proantigen determinants|
    CN102675430B|2005-08-12|2014-08-27|上海贺普药业股份有限公司|Hepatitis B virus surface L protein related peptide|
    EP2428801B1|2006-03-14|2014-05-07|Oregon Health and Science University|Methods for detecting a mycobacterium tuberculosis infection|
    US8945582B2|2006-09-07|2015-02-03|Glaxosmithkline Biologicals S.A.|Vaccine|
    KR100836745B1|2007-01-31|2008-06-10|두비엘|An hbv vaccine and a process of preparing the same|
    AU2008221383B2|2007-02-28|2012-09-13|The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services|Brachyury polypeptides and methods for use|
    CN101687028A|2007-05-02|2010-03-31|葛兰素史密丝克莱恩生物有限公司|Vaccine|
    EP2293813A4|2008-05-23|2012-07-11|Univ Michigan|Nanoemulsion vaccines|
    WO2010099472A2|2009-02-27|2010-09-02|The U.S.A. Of America, As Represented By The Secretary, Department Of Health And Human Services|Spanx-b polypeptides and their use|
    GB201105981D0|2011-04-08|2011-05-18|Glaxosmithkline Biolog Sa|Novel process|
    ES2752190T3|2012-09-14|2020-04-03|Us Health|Brachyury protein, adenoviral vectors encoding Brachyury protein and their use|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    US932587A| true| 1987-01-30|1987-01-30|
    [返回顶部]